Switch to DuckDuckGo Search
   May 29, 2009  
< | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 | 17 | 18 | 19 | 20 | 21 | 22 | 23 | 24 | 25 | 26 | 27 | 28 | 29 | 30 | 31 | >

Toggle Join/Part | bottom
[00:01:13] *** umccullough_aa1 has joined #haiku
[00:02:47] *** cherrypai has quit IRC
[00:04:23] *** umccullough_aa1 has quit IRC
[00:12:00] *** aljen has quit IRC
[00:12:25] *** Barrett` has quit IRC
[00:15:52] *** arjen_ has quit IRC
[00:17:06] *** mmu_man_ has joined #haiku
[00:18:10] *** mmu_man has quit IRC
[00:19:14] *** umccullough_aa1 has joined #haiku
[00:20:19] * mmadia really needs 2-d arrays in bash
[00:20:50] <geist> maybe some sort of variable name substition?
[00:21:00] <geist> foo$(a)$(b) or something
[00:21:48] <mmadia> http://tldp.org/LDP/abs/html/arrays.html "Example 26-17. Simulating a two-dimensional array, then tilting it" :)
[00:22:15] <mmadia> but basically, yeah
[00:25:16] *** Kokito has joined #haiku
[00:26:10] *** umccullough_aa1 has quit IRC
[00:32:00] <megaf> mmadia: hi you, im writing a tutorial about how to install haiku in hard drive, from Linux, but, i dont know where i can publish it, is possible to put in haiku-os.org? or something like that
[00:33:57] *** DrHouse_Compaq has quit IRC
[00:38:00] <mmadia> Kokito ---^ ?
[00:38:10] *** andreas_dr has quit IRC
[00:38:39] *** miqlas has quit IRC
[00:39:00] <mmadia> megaf : is this a translated tutorial? or .. ?
[00:39:20] *** redblue has joined #haiku
[00:39:39] <megaf> mmadia: i just wrote that in enlish
[00:39:55] <megaf> im going to publish in my blog
[00:40:03] <megaf> i have it in htmls, pdf and odt
[00:40:08] <megaf> html*
[00:40:10] <mmadia> well, we're trynig to re-organize the website documentation.
[00:40:17] <mmadia> let me dig up the thread about it.
[00:41:13] <mmadia> here it is : http://www.freelists.org/post/haiku-web/ReviewingUpdatingCombining-howto-guides-for-buildinginstalling-Haiku
[00:41:16] *** mmu_man has joined #haiku
[00:41:16] *** ChanServ sets mode: +o mmu_man
[00:41:47] <mmadia> megaf : basically, we're trying to consolidate all the various how-to guides into one collection.
[00:42:40] <mmadia> they'll be organized such that there is one guide for a particular aspect, like installing Haiku from source.
[00:43:26] <mmadia> and that one guide will branch out to mention platform specific notes. like on Mac OSX, you need this additional software. on Linux64-bit, you need that.
[00:44:15] *** mmlr has joined #haiku
[00:44:54] <mmadia> there's also a collection of guides here : http://svn.berlios.de/svnroot/repos/haiku/haiku/trunk/docs/userguide/en/installation/
[00:45:30] *** Prodego has left #haiku
[00:50:18] *** warpdesign has joined #haiku
[00:51:19] <megaf> mmadia: maybe it need some revision
[00:53:20] <megaf> mmadia: if you put odt you will download the odt version, lol
[00:54:34] <megaf> brb
[00:58:39] *** DrHouse_Compaq has joined #haiku
[01:02:25] <Kokito> megaf, anyone can submit a document on the website. all you need is an account
[01:03:19] <megaf> i have one
[01:03:30] <megaf> mmadia: so, what about my tutorial?
[01:18:14] *** mattlacey has joined #haiku
[01:19:22] * JonathanThompson screams in insane frustration
[01:24:44] *** adamk_ has quit IRC
[01:24:56] <svensko> JonathanThompson, this is Frasier, you're on the air
[01:25:14] <JonathanThompson> Is it illegal to do something illegal to collect a debt?
[01:25:26] * JonathanThompson reminds everyone he's insanely frustrated right now
[01:25:47] *** oco has quit IRC
[01:26:12] <svensko> two negatives make a positive
[01:26:41] <JonathanThompson> Interesting logic considering the problem domain.
[01:27:39] <svensko> three lefts make a right
[01:28:01] <JonathanThompson> That's true while driving, assuming you're not on a piece of road that'd have you go off the edge or into something solid in the process.
[01:30:34] *** mmu_man_ has quit IRC
[01:32:01] *** awpeter has quit IRC
[01:42:16] *** jprostko has joined #haiku
[01:46:17] *** umccullough_aa1 has joined #haiku
[01:55:43] *** mattlacey has quit IRC
[01:58:50] *** umccullough_aa1 has quit IRC
[01:59:55] *** TheNerd has joined #haiku
[02:00:12] *** mmlr has quit IRC
[02:02:58] *** BePhantom has joined #haiku
[02:04:47] *** svensko has quit IRC
[02:05:55] *** Xbertl has quit IRC
[02:16:15] *** Matias_ has joined #haiku
[02:26:27] *** BePhantom_ has joined #haiku
[02:26:33] *** BePhantom has quit IRC
[02:26:46] *** Matias_ has quit IRC
[02:32:14] *** thotypous has quit IRC
[02:32:51] *** svensko has joined #haiku
[02:33:00] <svensko> megaf, your instructions worked like a charm :)
[02:33:05] *** mmlr has joined #haiku
[02:33:41] <megaf> svensko: Cool!
[02:33:58] <megaf> svensko: the Haiku IRC Client is Vision
[02:34:08] <svensko> is there a client for AIM?
[02:34:13] <megaf> sure
[02:34:19] <megaf> one moment
[02:35:46] <megaf> svensko: now we have a problem
[02:36:04] <megaf> because the Haiku non gcc4, is compatible with BeOS apps
[02:36:07] *** DrHouse_Compaq has quit IRC
[02:36:13] <megaf> and there are a lot of AIM clients
[02:36:19] <svensko> ah, cool
[02:36:22] <megaf> but, you just installed the gcc4 version
[02:36:28] <megaf> and is not compatible
[02:37:17] <dwarfyperson> well, if you find an opensource one you can recompile
[02:37:22] <megaf> scanty: anyway, you can try http://www.haikuware.com/directory/internet-network/instant-messaging/
[02:37:24] <dwarfyperson> right?
[02:37:30] <megaf> dwarfyperson: right
[02:39:07] <megaf> svensko: my AIM is eumegaf
[02:39:26] <svensko> okay, cool
[02:39:55] <megaf> i have just a few of aim contacts
[02:39:58] <megaf> =/
[02:40:17] <megaf> aim is not popular at all here
[02:42:23] <svensko> really? it's THE thing used in america
[02:42:30] <svensko> which makes sense i guess
[02:43:20] <svensko> doesn't seem to want to connect to freenode
[02:45:11] <svensko> that's odd... my internet worked when i was running it from USB... and now that it's installed it doesn't seem to want to work
[02:45:35] *** xRaich[o]2x has quit IRC
[02:48:40] <dwarfyperson> I dunno about THE thing
[02:48:46] <dwarfyperson> I don't know anyone who uses aim
[02:49:04] <dwarfyperson> google talk mostly
[02:49:25] *** Kokito has quit IRC
[02:52:35] *** mattlacey has joined #haiku
[02:54:08] <svensko> rebooted and my networking is back :)
[02:54:11] * megaf uses
[02:55:01] *** svensko_haiku has joined #haiku
[02:55:26] <megaf> cool
[02:56:13] *** MegafEee has joined #Haiku
[02:56:33] <MegafEee> svensko_haiku, are you using vision?
[02:56:40] <MegafEee> yep
[02:56:42] <MegafEee> :)
[02:56:50] <MegafEee> [21:56] [svensko_haiku VERSION response]: Vision-0.9.7-H-090423 : Haiku/r30884 (2x1595MHz) : http://vision.sourceforge.net
[02:57:13] <svensko> yep, got it all working :)
[02:57:55] <MegafEee> svensko, dont forget one thing, haiku still alpha
[02:57:57] <MegafEee> so...
[02:58:05] <svensko_haiku> oh yeah, it's crashed a few times already :P
[02:58:16] <svensko_haiku> i'm not expecting a well polished system, i just want to see if i like it or not
[03:01:32] <CIA-9> bonefish * r30908 /haiku/trunk/src/add-ons/kernel/debugger/disasm/disasm.cpp: Fixed error handling in module initialization.
[03:01:42] <svensko> so i'm guessing no wireless yet? also doesn't appear to be a way to suspend/hibernate
[03:06:51] <MegafEee> svensko, not yet
[03:07:09] <MegafEee> ask to mmadia and mmu_man about that :P
[03:09:44] <mmadia> nope. someone is working on wireless through a bounty at HaikuWare.com
[03:10:05] <mmadia> just dont let the headlines mislead you.
[03:11:31] <svensko> headlines? what do you mean?
[03:12:04] <MegafEee> svensko, do you know haikuware?
[03:14:10] <svensko> i'm checking it out now :)
[03:14:11] <svensko> pretty neat
[03:14:25] <svensko> won't R2 strip haiku of BeOS binary compatibility?
[03:14:31] <mmadia> nope.
[03:14:42] <mmadia> the plan is to keep providing it.
[03:14:51] <svensko> ah, nice
[03:15:07] <CIA-9> bonefish * r30909 /haiku/trunk/headers/private/kernel/arch/x86/arch_int.h: (log message trimmed)
[03:15:07] <CIA-9> Not sure, if this was only a gcc 4.3.3 bug or if I misunderstand something, but
[03:15:07] <CIA-9> gcc could apparently assume that the register assigned to the one in the
[03:15:07] <CIA-9> clobber list would keep its value (as can be observed when disassembling
[03:15:07] <CIA-9> add_debugger_command_etc()).
[03:15:08] <CIA-9> Using a dummy output register works around the problem and also avoids the
[03:15:12] <CIA-9> unnecessary initialization of the register.
[03:15:19] * mmu_man actually goes to hibernate mode for 3h
[03:15:21] <mmu_man> n8
[03:15:35] *** mmu_man has quit IRC
[03:18:16] <BePhantom_> i just came back from the cinema, there was a girl that ruined the movie for me
[03:18:58] <BePhantom_> she wouldnt stop talking to herself, and she laughter was so annoying
[03:19:04] <BePhantom_> her*
[03:20:08] *** Sikosis has joined #haiku
[03:20:08] *** ChanServ sets mode: +o Sikosis
[03:20:46] <MegafEee> Oo
[03:21:11] <BePhantom_> and she laughed at the most unfunny parts
[03:22:22] *** Negr0 has quit IRC
[03:22:33] <megaf> mmadia: id like to have CIA-9 in my channel, is that possible?
[03:23:02] <mmadia> sure. i'm not sure how though.
[03:23:04] <BePhantom_> mr media, hello :)
[03:23:11] <mmadia> s/e/a
[03:23:58] <BePhantom_> hey, is it true that R2 will maintain BeOS binary compatibility?
[03:24:15] <BePhantom_> will it be gcc2/gcc4?
[03:24:31] <MegafEee> BePhantom_, i dont hink so, i cant run BeOS apps here,
[03:24:37] <MegafEee> and im using gcc2 version
[03:24:52] <BePhantom_> i thought R2 would drop gcc2
[03:25:14] <BePhantom_> and take distance from BeOS
[03:25:20] <mmadia> From what i've read in the archives, R2 will be gcc4 *and* it'll still provide binary compatibility for R1's gcc2 programs.
[03:25:47] <mmadia> R1's gcc4 programs may not be supported, since R1 won't officially be gcc4.
[03:26:56] <mmadia> http://www.freelists.org/post/haiku-development/GCC-2-x-GCC-4
[03:27:17] <mmadia> for clarity, this is the thread, that i'm basing my statements on.
[03:30:30] <MegafEee> mmadia, pvt again please, sorry
[03:37:49] <svensko> i keep getting this message when trying to run games - Coul dnot open "ire" (Missing symbol: Archive_C7BWindowP8BMessageb).
[03:38:48] *** svensko_haiku has quit IRC
[03:39:52] *** DrHouse_Compaq has joined #haiku
[03:40:54] *** DrHouse_Compaq has quit IRC
[03:41:36] <svensko> i'm guessing there's no multiple monitor support?
[03:42:18] <mmadia> iirc, not yet.
[03:50:24] <svensko> is the end goal of haiku to be meant for experts or new users?
[03:54:09] *** M199 has joined #haiku
[03:54:26] <MegafEee> svensko, end user
[03:54:38] *** Master199 has quit IRC
[04:05:59] *** umccullough_aa1 has joined #haiku
[04:08:20] *** pfoetchen has quit IRC
[04:08:23] *** pfoetchen has joined #haiku
[04:10:33] *** pfoetchen has quit IRC
[04:10:43] *** pfoetchen has joined #haiku
[04:20:09] *** LjL has quit IRC
[04:24:56] *** pfoetchen has quit IRC
[04:25:03] *** pfoetchen has joined #haiku
[04:27:49] *** ulterior_modem has quit IRC
[04:28:01] *** mmlr has quit IRC
[04:41:31] *** Verdant_Machine has left #haiku
[04:41:51] *** pfoetchen has quit IRC
[04:44:26] <Androo> are there frequently-updated source snapshots hosted anywhere?
[04:46:12] <mmadia> nope. you can see here about downloading the source code : http://www.haiku-os.org/node/2506/
[04:46:20] * JonathanThompson poits mmadia
[04:46:38] <mmadia> greetings
[04:46:59] <Androo> mmadia: thanks
[04:47:07] <JonathanThompson> I'm in a state of extreme frustration: below broke, with no promises of that changing anytime soon that I can count on.
[04:47:12] <Androo> mmadia: svn takes so long though :(
[04:47:36] <mmadia> Androo : grab a drink and watch tv
[04:47:38] <JonathanThompson> The iPhone thing fell through: someone else was chosen that has already published iPhone apps.
[04:47:46] <mmadia> or do it before bed
[04:47:47] <JonathanThompson> Multitask!
[04:48:02] * JonathanThompson votes on the bed solution: maximum efficiency of user overhead
[04:48:55] * JonathanThompson needs to quickly whip out his box-stuffing game
[04:49:23] <CIA-9> mmlr * r30910 /haiku/trunk/src/add-ons/kernel/file_systems/layers/write_overlay/write_overlay.cpp:
[04:49:23] <CIA-9> * Implement read/write_pages using Read()/Write(), io will follow later.
[04:49:23] <CIA-9> * Create a file cache for created overlay nodes. It is unused and disabled, but
[04:49:23] <CIA-9> causes a vnode cache to be created. This is required for mapping a file, which
[04:49:23] <CIA-9> in turn is required for executables to be loaded. With that copied or newly
[04:49:26] <CIA-9> created executables should work on top of write_overlay. Will think about and
[04:49:27] <CIA-9> implement a more direct way of getting that cache later today.
[04:59:19] *** mvfranz has joined #haiku
[05:17:04] *** mvfranz has quit IRC
[05:18:50] *** DrHouse_Dell has joined #haiku
[05:27:58] *** DrHouse_Dell has quit IRC
[05:30:33] *** megaf has quit IRC
[05:35:44] *** DrHouse_Compaq has joined #haiku
[05:40:59] *** DrHouse_Compaq has quit IRC
[05:47:36] *** glootech has quit IRC
[05:47:49] *** glootech has joined #haiku
[05:48:49] *** DrHouse_Compaq has joined #haiku
[05:51:55] *** Paradoxon has joined #haiku
[05:53:04] *** Travissimo has joined #haiku
[05:53:20] <Travissimo> Is anyone else having trouble with the latest version of GCC?
[05:53:22] *** umccullough_aa1 has quit IRC
[05:54:27] <Travissimo> const char* != char*
[05:54:29] <Travissimo> anybody???
[05:54:45] <geist> well, that is true
[05:54:49] <geist> is this C or c++?
[05:55:22] <Travissimo> c++
[05:55:28] <Travissimo> well, geist
[05:55:30] <Travissimo> the thing is
[05:55:43] <Travissimo> this used to not stop g++ from compiling...now it does
[05:55:49] <geist> okay
[05:55:57] <geist> guess they elevated it to an error
[05:56:00] <Travissimo> and old, old code that used to compile in haiku no longer does
[05:56:10] <Travissimo> (as well as stuff from e17)
[05:56:27] <Travissimo> i feel like i'm the only man in the world facing this
[05:56:39] <geist> dunno
[05:57:11] <Travissimo> all that google has to say about it is snotty programmers saying, "Yup...g++ is right: const char* is not char*." But lots of code does this, apparently
[05:57:26] <geist> well, it is right
[05:57:27] <Travissimo> Stupid archlinux with your cutting edge packages!
[05:57:29] <Travissimo> grrrr
[05:57:37] <geist> in C it's i think less defined
[05:57:42] <geist> but in C++ it is absolutely right
[05:57:57] <Travissimo> Someone should inform a certain file called "fs.cpp"
[05:58:06] <geist> fix it
[05:58:13] <Travissimo> heh
[05:58:19] <Travissimo> i don't think i really know how
[05:58:27] <Travissimo> I tried using some something
[05:58:34] <Travissimo> but i don't think it fixed it
[05:58:57] <Travissimo> i downgraded gcc, but that causes dependency issues
[05:59:50] <Travissimo> and it's taken me so much "tinkering" to find the problem, my generated folder or something is blehhhh.
[06:00:30] <Travissimo> I'm compiling now...i will let the room know of the errors that occur. Please help! :)
[06:00:49] <Travissimo> InitScript1 generated/haiku.image-init-vars
[06:00:49] <Travissimo> C++ generated/objects/linux/x86/release/build/libbe/support/String.o
[06:00:49] <Travissimo> src/build/libbe/support/String.cpp: In member function ‘int32 BString::_FindAfter(const char*, int32, int32) const’:
[06:00:49] <Travissimo> src/build/libbe/support/String.cpp:2121: error: invalid conversion from ‘const char*’ to ‘char*’
[06:00:49] <Travissimo> src/build/libbe/support/String.cpp: In member function ‘int32 BString::_IFindAfter(const char*, int32, int32) const’:
[06:00:51] <Travissimo> src/build/libbe/support/String.cpp:2133: error: invalid conversion from ‘const char*’ to ‘char*’
[06:00:53] <Travissimo> src/build/libbe/support/String.cpp: In member function ‘int32 BString::_ShortFindAfter(const char*, int32) const’:
[06:00:56] <Travissimo> src/build/libbe/support/String.cpp:2145: error: invalid conversion from ‘const char*’ to ‘char*’
[06:01:10] <svensko> pastebin is your friend O_O
[06:01:15] <Travissimo> String.cpp seems pretty darn improtant
[06:01:23] <Travissimo> pastebin?
[06:01:31] * Travissimo consults the google
[06:01:51] <geist> yes, please dont paste tons of stuff int he channel
[06:02:18] <Travissimo> ah
[06:02:21] <Travissimo> sorry :(
[06:02:24] *** umccullough has quit IRC
[06:02:37] *** pyCube_ has joined #haiku
[06:02:45] *** umccullough has joined #haiku
[06:02:47] <mmadia> there's even a link in Topic
[06:03:07] <pyCube_> shud
[06:03:42] <Travissimo> Sorry, sorry, sorry...I'm really quite bumbling
[06:03:50] <Travissimo> http://pastebin.com/m4707d8fc
[06:04:10] <Travissimo> Oh look
[06:04:17] <Travissimo> there's even a haiku thingee
[06:04:46] <mmadia> or http://travissimo.pastebin.com for a personal touch ;)
[06:04:46] <jprostko> probably need an #include <cstring> in there somewhere
[06:05:16] <Travissimo> http://haiku.pastebin.com/m186e9e7a
[06:05:36] <Travissimo> I don't think including cstring would help much...it has to do with type conversions
[06:06:49] <jprostko> i just know i've encountered it with gcc 4.4 stuff
[06:06:59] <Travissimo> exactly
[06:07:23] <Travissimo> so, jprostko, that line will fix everything?
[06:08:02] <geist> but yeah, just adding a const in front of those should help
[06:09:06] <geist> it depends on how strstr is defined on the platform
[06:09:26] <geist> legacy it's defined to return char *, but maybe newer versions return const char
[06:09:36] <geist> but in this case if the ptr variable was made const char *, it should solve it
[06:09:39] <Travissimo> including cstring did not work, jprostko
[06:09:59] <geist> try that Travissimo
[06:10:06] <jprostko> yeah, i kind of figured that. do what geist said
[06:10:50] <Travissimo> const_cast<char*>(BLAHBLAHBLAH)
[06:10:54] <Travissimo> apparently does
[06:11:06] <geist> just change
[06:11:10] <geist> char *ptr
[06:11:11] <geist> to
[06:11:13] <geist> const char *ptr
[06:11:15] <geist> see if that fixes it
[06:11:21] <jprostko> http://gcc.gnu.org/gcc-4.4/porting_to.html ... see Strict null-terminated sequence utilities section on the page
[06:11:21] <Travissimo> no
[06:11:33] <geist> it depends on what part of the line it's bitching about
[06:11:37] <geist> the return or the argument
[06:11:38] <Travissimo> because sometimes that just doesn't work for reasons i'm too naive to explain
[06:13:18] <Travissimo> oooooh!
[06:13:20] <Travissimo> look at me!
[06:13:27] <Travissimo> i fixed code!
[06:13:34] <Travissimo> let's see if it actually runs
[06:14:04] <Travissimo> blerf
[06:14:05] <Travissimo> nope
[06:14:43] *** Hugen has joined #haiku
[06:14:46] <Hugen> hi
[06:14:51] <Travissimo> hiya
[06:16:57] <MegafEee> mmadia, im running beos here, LiveCD mode
[06:17:05] <mmadia> nice
[06:17:07] <Travissimo> oooooh!
[06:17:11] <MegafEee> but it doesnt recnize my network card
[06:18:39] <MegafEee> and also my usb drive
[06:18:52] <MegafEee> so, i dont know how to install the driver
[06:18:59] <MegafEee> there are a driver in bebits
[06:19:26] <mmadia> well, it's BeOS.
[06:19:42] <Travissimo> ugh
[06:19:45] <mmadia> it's approaching 10years of age.
[06:20:00] <MegafEee> mmadia, but still great
[06:20:09] <MegafEee> looks like a new os
[06:20:31] <MegafEee> ill install it on QEMU
[06:20:55] <mmadia> if you get it running on QEMU, i'll definitely be interested :)
[06:21:43] <MegafEee> well, if i got windows 3.11 running on freedos running on qemu
[06:23:52] <Travissimo> So...ummm...where do I report this error? I would think that even though it compiles in older versions, some smart person who understands const char*'s and such would like to fix this
[06:23:52] *** MrSunshine has quit IRC
[06:23:52] *** rkbm has quit IRC
[06:23:52] <mmadia> Travissimo : what software is it for?
[06:23:52] <MegafEee> mmadia, it doesnt start to load
[06:23:52] <MegafEee> :S
[06:23:52] <Travissimo> Haiku
[06:24:33] <JonathanThompson> Travissimo: I see you fixed the code so perfectly, it didn't work :D
[06:24:37] * JonathanThompson loves days like that
[06:24:43] <Travissimo> hehehehe
[06:24:47] <Travissimo> yup
[06:25:03] <Travissimo> The thing I tried apparently worked in fs.cpp but not in String.cpp
[06:25:07] <Travissimo> and I have no idea why
[06:25:14] <Travissimo> BECAUSE I'M NOT A PROGRAMMER!!!!!!
[06:25:17] <Travissimo> AHHHHHHH!
[06:25:23] <mmadia> eh, dev.haiku-os.org as a bug or possibly the general haiku mailing list
[06:25:25] *** rkbm has joined #haiku
[06:25:30] <Travissimo> I can't wait til smart people start bumping into this
[06:25:41] <JonathanThompson> Travissimo: if you're not careful, you may soon earn a reputation as one :P
[06:25:47] <Travissimo> until then, i'll just have to wait to compile haiku again
[06:25:50] <Travissimo> heh
[06:26:16] <Travissimo> just imagine it: Haiku will be in BETA before I can *ever* compile again!!!! grrrrrrrr!
[06:26:42] * JonathanThompson wonders how many years Travissimo has to wait for that milestone :D
[06:27:00] <Travissimo> by then, maybe everyone will have upgraded their gcc
[06:27:21] <Travissimo> (Of course, Haiku is no stranger to problems in upgrading gcc...)
[06:27:28] <Travissimo> l8ta
[06:27:30] *** Travissimo has left #haiku
[06:27:39] *** DrHouse_Dell has joined #haiku
[06:28:26] *** DrHouse_Compaq has quit IRC
[06:31:03] *** Androo has quit IRC
[06:32:27] *** AlienSoldier has joined #haiku
[06:33:15] <MegafEee> mmadia, i got it running on virtual box
[06:33:35] <mmadia> that's not QEMU.
[06:33:57] <MegafEee> ir freezes
[06:34:00] *** Bumphead1 has quit IRC
[06:34:01] <mmadia> having it running in QEMU would allow us to virtualize BeOS inside Haiku :D
[06:34:10] <MegafEee> hm
[06:34:20] <MegafEee> that would be fantastic
[06:34:48] <mmadia> there's this site, but i never made heads or tails about it : http://www.oggfrog.com/howto/emulators/beos.html
[06:35:31] <mmadia> that person's even active on the mailing lists actually.
[06:35:41] *** Al2O3 has joined #haiku
[06:36:47] *** MrSunshine has joined #haiku
[06:38:49] <MegafEee> bah
[06:39:07] *** thylacine has joined #haiku
[06:39:14] <MegafEee> mmadia, when almost everytime i try to run BeOS or Haiku on QEMU i got Kernel Panic?
[06:39:28] *** jprostko has quit IRC
[06:39:28] <mmadia> *shrugs*
[06:39:29] <MegafEee> and it only happens if i try BeOS or Haiku
[06:40:17] <mmadia> i don't know *everything* about BeOS/Haiku
[06:40:22] <mmadia> :)
[06:41:06] <MegafEee> you do!
[06:41:13] <MegafEee> i know you do
[06:41:14] <MegafEee> :P
[06:41:38] *** Paradoxon has quit IRC
[06:41:49] <MegafEee> are there any X window syste for Haiku?
[06:42:00] *** Paradoxon has joined #haiku
[06:42:03] <MegafEee> system*
[06:43:32] <pyCube_> yuore asking to get pounded with comments about how old and crappy x window stuff is
[06:43:52] <MegafEee> sometimes is alot useful
[06:43:58] <pyCube_> i know
[06:44:00] *** redblue has quit IRC
[06:44:01] <pyCube_> i like x
[06:44:04] <MegafEee> i have X windows system in my iPod Touch
[06:44:17] <dwarfyperson> why would you do that?
[06:44:24] <MegafEee> so, i can run all my Linux software everywhere
[06:44:36] <MegafEee> also remote desktop
[06:45:54] *** DrHouse_Dell has quit IRC
[06:45:56] *** thylacine is now known as jprostko
[06:49:01] *** DrHouse_Dell has joined #haiku
[06:50:33] *** paul0 has quit IRC
[06:51:03] *** DrHouse_Dell has quit IRC
[06:51:16] *** DrHouse_Compaq has joined #haiku
[06:55:19] *** redblue has joined #haiku
[06:57:56] <BePhantom_> MegafEee, i thought you said you didnt like linux
[06:58:13] <MegafEee> i dont
[06:58:26] <MegafEee> but i need an operation system
[06:58:32] <MegafEee> haiku is to young
[06:58:38] <MegafEee> beos too old
[06:58:40] <MegafEee> too*
[06:58:41] <MegafEee> so
[06:58:43] <pyCube_> i like useful software that works reliably
[06:58:50] <BePhantom_> what distro are you using MegafEee
[07:00:19] <MegafEee> BePhantom_, Mandriva 2009.1
[07:00:23] <BePhantom_> pyCube_ well jaunty is not *that* reliable :)
[07:00:36] <BePhantom_> MegafEee, is that spring?
[07:00:43] <MegafEee> oops
[07:00:43] <pyCube_> BePhantom_: it hasnt not-worked for me yet
[07:00:51] <MegafEee> Mandriva 2008.1 or 2008 Spring
[07:01:25] <BePhantom_> pyCube_ you're lucky, jaunty got some serious bugs :)
[07:02:10] <BePhantom_> MegafEee, is it good?
[07:05:43] <MegafEee> i like
[07:07:04] <BePhantom_> i'm looking forward to fedora 11, but it has been delayed again
[07:07:09] <BePhantom_> twice
[07:07:45] *** Paradoxon has quit IRC
[07:08:16] <BePhantom_> MegafEee, you're using mandriva 2009 spring right?
[07:08:29] <svensko> MegafEee, there's always Windows Vista XD
[07:09:06] <MegafEee> BePhantom_2008
[07:09:10] <MegafEee> 2009.1 sux
[07:09:15] <MegafEee> the worse mandriva ever
[07:09:40] <BePhantom_> really? why?
[07:09:46] *** DrHouse_Compaq has quit IRC
[07:09:49] <svensko> i'm not a fan of the new jaunty either... like pyCube said, useful reliable software is a plus
[07:10:09] <MegafEee> BePhantom_, use it and see
[07:10:26] <pyCube_> i dunno.. i have never really had any problems with ubuntu.. been using it since badger betas
[07:10:58] <pyCube_> but certainly the last several releases have been flawless for me
[07:11:01] <svensko> it's the small things that get to me... random firefox and pidgin crashes, terrible multiple monitor support
[07:11:16] <BePhantom_> MegafEee, i will some day, i don't really feel like i need another OS atm, Intrepid Ibex works really well here
[07:11:43] <pyCube_> svensko: multiple monitor stuff got very easy/nice in with jaunty for me
[07:11:59] <svensko> i am using xubuntu, so that may be the issue
[07:12:05] <pyCube_> ah
[07:12:16] <pyCube_> i never bothered with any buntu variant
[07:12:43] <pyCube_> its easy enough to install xubuntu packages when i decide to try xfce
[07:12:51] <svensko> i'm still not sure what i want to run during grad school, but i know i want to pick something and stick with it
[07:13:14] <pyCube_> thats kinda what i did
[07:13:50] <pyCube_> ubuntu was the first distro that worked well, was easy to manage, and had massive default repos
[07:13:55] <svensko> i was hoping haiku would have matured a bit faster, but what can you do
[07:14:00] <pyCube_> so i stuck with it..
[07:14:15] <svensko> yeah, i may stick with xubuntu... it is the least painful experience thus far
[07:14:21] <pyCube_> endured a few glitches here and there early on, but was still better than anythign else for my needs
[07:14:23] *** DrHouse_Compaq has joined #haiku
[07:15:30] <BePhantom_> i wish jaunty would work better with intel video
[07:15:30] <svensko> i was tempted by OS X but i honestly feel more comfrotable with linux
[07:17:05] <pyCube_> svensko: yeah, i am on a macbook pro right now.. ran osx for about a year on it, but eventually install ubuntu.. it instantly became many times more useful/enjoyable to use
[07:17:24] *** dhdell has joined #haiku
[07:17:28] <svensko> i was tempted by the MB but i heard that it doesn't play nice with Linux
[07:17:53] <pyCube_> works perfectly for me
[07:17:58] <svensko> plus i prefer 12" laptops and lenovo is releasing the S12 (with nvidia ION graphics) _hopefully_ next month
[07:18:02] <pyCube_> everything worked 'out of the box'
[07:18:13] <BePhantom_> pyCube_ would you say that ubuntu is faster than osx?
[07:18:21] <pyCube_> well, after i installed the macbook specific packages
[07:18:43] <svensko> wow, that's pretty wild then, i peered at the ubuntu documentation page for Linux on apple products and there was red everywhere
[07:19:25] <pyCube_> BePhantom_: yeah.. i many ways.. i dunno about computation speeds or anythign.. but its much faster to find/install software, and the window management is billions of times better/faster, etc
[07:19:41] <pyCube_> ...in many ways...
[07:19:49] <svensko> i've heard the finder is a pain in the wang
[07:20:23] <pyCube_> manipulating windows in osx is hell
[07:20:33] *** dhdell has quit IRC
[07:20:44] <BePhantom_> i never used osx so i cant even compare it to xp
[07:20:53] <pyCube_> resizing is a bitch, cant send to back, etc
[07:21:13] <svensko> not sure if you guys have seen this but: http://img.waffleimages.com/47cd315500ae363f8defbea88c925cdc52aa6825/240ccede5360b093dbf298f8946025a5.png
[07:21:32] <BePhantom_> svensko, you are a gsoc student?
[07:21:43] <svensko> nope, i'm still learning python :)
[07:22:01] <svensko> i'm a geneticist, just got a BS on genetics from Clemson, heading to grad school at NCSU in fall
[07:22:45] <MegafEee> ok
[07:22:50] <MegafEee> good night people
[07:23:03] <BePhantom_> wow, so you could bring back dinosaurs right?
[07:23:04] <BePhantom_> :D
[07:23:31] <BePhantom_> boa noite MegafEee
[07:23:37] <pyCube_> one of the first large-ish programs i ever made was a "genetics" program on the c64 that i made for extra credit in 9th grade biology
[07:23:44] <svensko> night MegafEee thanks gain for the help with the haiku instlal!
[07:23:59] <svensko> well then i envy your coding abilities :P
[07:24:00] *** DrHouse_Compaq has quit IRC
[07:24:21] <svensko> i've never coded anything large by any stretch of the imagination... the research lab i'm working for this summer have a few requests that i think will at least help me get my feet wet
[07:24:25] <MegafEee> no problem :) i might publish that tomorrow
[07:24:50] <pyCube_> svensko: it was a pathetic basic app..hehe.. seriously wrong. it did manage to calculate breeding Rr with RR, etc
[07:24:54] <pyCube_> hehe
[07:25:03] <svensko> oh, population genetics, nice
[07:25:19] <svensko> the lab i am looking at deals with butterfly genomics
[07:26:14] <pyCube_> once in that class my friend and i accidentally caused a kid in thailand to shout "big R little R"
[07:26:29] <pyCube_> ...well, thats the story we told ourselves anyway...
[07:26:58] <svensko> o_O
[07:27:02] <pyCube_> we were actually trying to help another friend solve a problem on the board by rubbin gour temples and thinking really hard
[07:27:08] <svensko> pyCube, judging by your user name i assume you know python?
[07:27:13] <pyCube_> but we mis-aimed
[07:27:20] <svensko> ha
[07:27:25] *** mmadia has quit IRC
[07:28:01] <pyCube_> svensko: yeah.. i learned python.. on/because of beos .. hehe
[07:28:19] <svensko> do you remember which book you used? just curious
[07:28:20] <pyCube_> back in like 2001-ish
[07:28:26] <pyCube_> i didnt
[07:28:47] <svensko> i attempted to use dive into python but it was insanely fast paced so i moved back to thinking like a computer scientist: python
[07:28:48] <pyCube_> i had the python standard library book and a problem to solve
[07:29:07] <svensko> sounds like you had prior programming experience though :)
[07:29:52] <pyCube_> well, some c64 basic and ancient 6502 assembly.. but it had been years, and is totally different
[07:29:56] <pyCube_> but yeah
[07:30:29] <svensko> it's going to be nice having biopython at my disposable
[07:30:40] <pyCube_> my main motivation was that i didnt want a life of shitty jobs like stocking shelves or lumber mills
[07:30:43] <svensko> err disposal
[07:31:11] <svensko> can't say i blame ou
[07:31:54] <pyCube_> ended up catching a couple extremely lucky breaks
[07:32:15] <pyCube_> found myself in a position where i HAD to learn FAST,, hehe
[07:32:42] <svensko> that's sorta where i am :)
[07:33:19] <svensko> i have this week and next week then i serve as a counselor to research interns at night/during the weekends and also have my days full, then i have 2.5 weeks and i'm going to be in a lab hopefully programming
[07:33:31] <pyCube_> well, i had people investing a bunch of $$ in my abilities that i assumed i could have if i had to...hehe
[07:33:37] <svensko> plus there are a few projects i'd like to start on too
[07:33:50] <svensko> ah
[07:34:16] <svensko> i started perl last summer but switched over to python during this summer
[07:34:47] <svensko> i know perl is the main language for bioinformatics but people have been telling me to use python since i've attempted to start learning this stuff
[07:34:49] *** jprostko has quit IRC
[07:35:20] <pyCube_> well, of the two, one is easier to learn and one of more broadly useful... that one is python.. hehe
[07:36:17] <svensko> yeah, i was told that my code that i did during my first year would look like spaghetti during my fifth year
[07:36:41] <pyCube_> sometimes i look at my old beos code.. its interesting.. hehe
[07:38:10] <svensko> i'm trying to instill good programming habits now so my future self doesn't want to come back and kick my current self in the ass for doing something stupid
[07:38:15] <pyCube_> i wrote a chat client for beos, then ended up porting/rewriting it many times in various ways.. qt, gtk, boo, jython/swing, web/ajax.. it neat looking at how my skills evolved iterating over essentially the same problems
[07:40:52] * MegafEee is idle: sleep
[07:40:56] * MegafEee is idle: sleeping
[07:41:50] <BePhantom_> pyCube, which chat client?
[07:42:35] <pyCube_> a muscle (beshare) client.. creatively named 'pychat'
[07:43:14] <pyCube_> pychat2 was unique in its ability to connect to multiple servers.. ooOOOoo
[07:43:23] <pyCube_> hehe
[07:44:48] <svensko> more than i'll be able to do any time soon :P
[07:45:16] <pyCube_> hot with that attitude anyway.. :-p
[07:45:18] <pyCube_> not
[07:46:27] <pyCube_> its really not very tough to get to the point of writing code that works.. then its just time/experience to get to be able to write efficient, good code
[07:46:56] <pyCube_> i think the mistake people make is worrying about the later first.. which is just depressing
[07:47:22] <pyCube_> i say, when youre learning, code that works is good code..
[07:47:31] <svensko> yeah, i expect to start off poorly
[07:47:39] <pyCube_> its not por
[07:47:41] <pyCube_> poor
[07:47:43] <svensko> i'll admit that i don't have a programmer's mind
[07:47:46] <pyCube_> its what your know
[07:47:49] <pyCube_> you
[07:48:03] <svensko> i figure the only way i can improve is through experience
[07:48:21] <pyCube_> really, in the end if a machine does the job, it does the job
[07:48:32] <svensko> which is why i'm willing to take on bigger challenges now (as long as my lab manager realizes it'll "take some time")
[07:48:47] <pyCube_> regardless of the mess inside the box, should one look
[07:49:00] <pyCube_> hehe
[07:49:23] <svensko> i'm going to be working with "bioinformaticists" that are typically from a comp sci background so i expect to be schooled in the beginning
[07:49:29] <svensko> but, like i said, at least i have biopython at my aid
[07:49:33] <pyCube_> making messes, then having to maintain it is a great way to get motivated to learn better practices
[07:50:45] <pyCube_> and when you dive in and make functional messes, suddenly all the books and articles and coding make sense because you have a foundation to base it on.. then learning better ways and new stuff becomes incredbly simple
[07:50:58] <svensko> i have large plans, eventually, but i figure i have to start somewhere
[07:52:04] <BePhantom_> pyCube_ what kind of computers do you or your work mates use for 3d animation?
[07:52:32] <pyCube_> amd based hp's
[07:53:02] <svensko> are you guys australian?
[07:53:12] <BePhantom_> can you tell me some of the specs? or is that a secret
[07:53:16] <pyCube_> running linux, sometimes windows
[07:53:24] <pyCube_> svensko: no.. california
[07:53:31] <svensko> ah
[07:53:40] <BePhantom_> svensko, I'm Argentinian
[07:53:42] <svensko> south carolina here, almost bed time actually!
[07:53:58] <pyCube_> BePhantom_: i really dont know what the desktop specs are.. dont really care.. heh
[07:54:17] <BePhantom_> pyCube_ I was asking about the workstations actually
[07:54:25] <BePhantom_> the big computers :)
[07:54:25] <pyCube_> thats what i mean
[07:54:36] <BePhantom_> oh ok
[07:54:44] <pyCube_> i dunno what the difference is between workstation and desktop
[07:54:49] <pyCube_> but ok
[07:55:06] *** Hugen has quit IRC
[07:55:19] <BePhantom_> well, the workstation are the ones where you do the intensive 3d processing and rendering
[07:55:22] <pyCube_> all our machines are the same, as far as machines that people physically use
[07:55:55] <pyCube_> there is a farm for doing rendering
[07:56:09] <pyCube_> many more servers/cores than i can imagine
[07:56:10] <pyCube_> heh
[07:56:16] <BePhantom_> :D
[07:56:26] <BePhantom_> do they run linux?
[07:56:31] <svensko> argh, one thing that kills me is that most of the examples at the end of this python book are heavily math based
[07:56:37] <pyCube_> believe so
[07:56:48] <svensko> i can do calculus all day long if i have to, but i'd prefer not to if i could help it :P
[07:57:18] <BePhantom_> svensko, i bought a o'reilly's book on python, it's really dusty now :D
[07:58:04] <svensko> i know there's a few books specially on using python in bioinformatics... perhaps after i finish this book i'll use it as a base to help speed me through the more complex bioinformatics material
[08:00:30] <pyCube_> svensko: what sort of stuff is involved with bioinformatics?
[08:00:43] <pyCube_> i mean, what are the programming problems?
[08:00:49] <pyCube_> er
[08:01:10] <svensko> honestly most of the ones i'll be dealing with in my current lab are along the lines of just saving people time and heaches
[08:01:20] <pyCube_> like, is it math/computationally intense? relational db-ish?
[08:01:22] <pyCube_> etc
[08:01:22] <svensko> however there are definitely issues on the horizon when next-gen sequencing becomes common
[08:01:32] *** DrHouse_Compaq has joined #haiku
[08:01:51] <svensko> well, to give you an idea, the new machines are able to make 11 TB of data from a single strand of DNA
[08:02:08] <pyCube_> sure.. but what is the data.. what needs to happen to it?
[08:02:09] <svensko> an entire strand, so a few billion bases, but still, that's what the future of bioinformatics is looking at
[08:02:45] <svensko> well since it will be entire genomes it opens a lot of doors
[08:03:08] <svensko> previously it took weeks to amplify, and sequence a subset of genes (ie 5) in a set of individuals (ie 12 individuals)
[08:03:14] <pyCube_> i am curious what the data is/looks like
[08:03:30] <svensko> atgcatgcatgcagtcagtcagtcagtcgcatatcg off into the horizon :P
[08:03:55] <svensko> just picking, there's more to it such as protein modeling using biophysics, etc.
[08:04:12] <pyCube_> sounds fun
[08:04:57] * dwarfyperson wonders what that strand codes for
[08:04:58] <dwarfyperson> actually
[08:05:01] <dwarfyperson> I could check
[08:05:15] <dwarfyperson> but I can't be arsed
[08:06:06] <svensko> one of the labs i may work in deals with tracking specific markers throughout the genome over the course of artificial evolution, less computer based, but could still be heavily aided by computers
[08:06:38] <svensko> another is deals with the formation of evolution models and then the testing of these evolution models, this one also greatly interests me
[08:08:07] <svensko> you can use a single gene to create a phylogeny, which is a tree showing the relationship among species/populations, etc based on their DNA sequence, this shows how some groups may have evolved similarly while others may have more distinct sequence
[08:08:11] <BePhantom_> svensko, if your lab say.. makes some important discovery do you share it with the rest of the scientific community? or do you keep if for yourself and patent it or something?
[08:08:17] <AlexForster> how do i say i don't develop internet applications
[08:08:28] <AlexForster> what's the opposite of a web applications programmer
[08:08:40] <dwarfyperson> a real programmer?
[08:08:42] <pyCube_> a liar programmer
[08:08:44] <dwarfyperson> SNAP!
[08:08:55] <dwarfyperson> :P
[08:09:01] <svensko> i just did a 1 year research project for undergrad where i took a few genes (four), got the sequenced for 32 species in a genus, and then created phylogenies and observed what type of evolution was taking place
[08:09:35] <svensko> this was considered pretty serious for that genus as it had never been done, and even with a few weeks we were able to tell a lot about the relationship among the species... now imagine if we had a few million genes to work with :)
[08:10:03] <svensko> BePhantom_, your entire goal, as sad as it is, is to get your work published to increase your chance of getting funded again
[08:10:07] <pyCube_> think of the hd space!
[08:10:32] <svensko> so while you may want to share a few things, some labs have been known to be cutthroat and keep their information under wraps if they have competitions, at least until they can have their work published
[08:10:48] <BePhantom_> svensko, that sucks :P
[08:10:58] <svensko> there are collaborations between labs though
[08:11:17] <svensko> where resources/knowledge can be shared and credit distributed based on who did what % of work
[08:11:39] <svensko> i believe the woman who owns my lab was in a collaboration once with 4 or 5 other universities around america
[08:13:16] <svensko> BePhantom_, it sorta sucks that you are established to "publish or perish" but that's the way the university stays profitable... you can sit around doing meaningful research all day long but if you aren't getting grants (which my university, i know, takes 40% off the top automatically), then you are dead weight
[08:13:27] <svensko> *expected, not established
[08:16:05] <svensko> alright, bedtime for me, night everyone
[08:16:43] <pyCube_> big R little R!
[08:16:49] <BePhantom_> goodnight svensko
[08:22:30] *** DrHouse_Compaq has quit IRC
[08:29:02] *** Paradoxon has joined #haiku
[08:35:00] *** V_machine has joined #haiku
[08:36:47] *** BePhantom_ has quit IRC
[08:38:22] *** DrHouse_Compaq has joined #haiku
[08:41:10] *** DrHouse_Compaq has quit IRC
[08:41:10] *** V_machine has quit IRC
[08:46:34] *** DrHouse_Compaq has joined #haiku
[08:47:04] *** cherrypai has joined #haiku
[08:50:43] *** V_machine has joined #haiku
[08:55:47] *** V_machine has quit IRC
[09:01:11] *** V_machine has joined #haiku
[09:03:09] *** V_machine has quit IRC
[09:05:27] *** SprMa has joined #haiku
[09:06:06] *** SprMa has left #haiku
[09:06:44] *** DrHouse_Compaq has quit IRC
[09:13:40] *** Sikosis has quit IRC
[09:24:23] *** mattlacey has quit IRC
[09:25:34] *** mattlacey has joined #haiku
[09:25:51] *** mattlacey has quit IRC
[09:28:07] *** Skar1 has joined #haiku
[09:39:13] *** AlexForster has quit IRC
[09:39:50] *** cherrypai has quit IRC
[09:40:55] *** cherrypai has joined #haiku
[09:41:41] *** cherrypai has quit IRC
[09:42:41] *** cherrypai has joined #haiku
[09:44:15] *** cherrypai has quit IRC
[09:47:30] *** cherrypai has joined #haiku
[09:49:07] *** cherrypai has quit IRC
[09:52:21] *** cherrypai has joined #haiku
[09:53:56] *** cherrypai has quit IRC
[09:54:57] *** RHarmsen has joined #haiku
[09:58:25] *** andreas_dr has joined #haiku
[09:58:38] *** Skar1 has left #haiku
[09:59:19] *** mmu_man has joined #haiku
[09:59:19] *** ChanServ sets mode: +o mmu_man
[10:00:08] *** cherrypai has joined #haiku
[10:01:37] *** cherrypai has quit IRC
[10:04:25] *** cherrypai has joined #haiku
[10:10:02] *** nikla has joined #haiku
[10:13:34] *** andreas_dr has quit IRC
[10:16:24] *** pyCube_ has quit IRC
[10:33:39] *** mattlacey has joined #haiku
[10:52:53] *** Ingenu has joined #Haiku
[10:54:15] *** mattlacey has quit IRC
[11:12:20] *** mmu_man has quit IRC
[11:38:55] *** mattlacey has joined #haiku
[11:42:05] *** UiX has joined #haiku
[11:47:50] *** M199 is now known as Master199
[12:11:51] *** mattlacey has quit IRC
[12:32:55] *** adamk_ has joined #haiku
[12:45:19] *** redblue has quit IRC
[12:46:41] *** SprMa has joined #haiku
[12:49:36] *** SprMa has left #haiku
[13:10:54] *** adamk_ has quit IRC
[13:12:10] *** mmu_man has joined #haiku
[13:12:10] *** ChanServ sets mode: +o mmu_man
[13:15:52] *** mmu_man has quit IRC
[13:18:09] *** xRaich[o]2x has joined #haiku
[13:21:40] *** nikla is now known as nikla|away
[13:28:19] *** nikla|away is now known as nikla
[13:29:30] *** hisoka999 has joined #haiku
[13:30:25] *** adamk_ has joined #haiku
[13:46:48] *** Zaranthos_1 has joined #Haiku
[13:48:52] *** pfoetchen has joined #haiku
[13:50:17] *** Zaranthos has quit IRC
[13:51:31] *** Zaranthos_1 is now known as Zaranthos
[14:03:15] *** Zaranthos_1 has joined #Haiku
[14:07:34] *** adamk_ has quit IRC
[14:13:08] *** Zaranthos has quit IRC
[14:13:08] *** Zaranthos_1 is now known as Zaranthos
[14:20:13] *** Hugen_ has joined #haiku
[14:20:17] <Hugen_> hey
[14:22:06] *** miqlas has joined #haiku
[14:22:44] <Hugen_> hi miqlas
[14:22:50] <miqlas> Hello Hugen!
[14:27:21] <Hugen_> miqlas: When you visit Poland again?
[14:28:06] <miqlas> Sorry, I dont know, but i wanna go back. I like Poland.
[14:28:13] <miqlas> Are You from Poland, Hugen?
[14:30:04] <miqlas> http://www.haiku-os.pl/userinfo.php?uid=152 :)
[14:30:14] <miqlas> It seem You are from Poland :)
[14:30:53] <Hugen_> miqlas: You don't know?
[14:30:56] <Hugen_> he he
[14:30:59] <Hugen_> ;)
[14:31:26] <Hugen_> exacly
[14:31:33] <Hugen_> exactly
[14:31:54] *** helf|nec has joined #haiku
[14:32:21] <miqlas> No, sorry. I remeber 2 years ago i posted an massage to the haiku-os.pl forum, I like to drink some beer /vodka with the Haiku fans from Poland. It was good :)
[14:32:33] <Hugen_> you gave me publicly :P
[14:32:40] <helf|nec> hi
[14:32:42] <Hugen_> yes, I rember this post too
[14:32:46] <Hugen_> hi helf
[14:32:55] <miqlas> I drunk 0 hours long with an Guy :)
[14:33:01] <miqlas> *10*
[14:33:11] <helf|nec> good god
[14:33:32] *** andreas_dr has joined #haiku
[14:33:43] <Hugen_> miqlas: you know from who you drink?
[14:33:56] <Hugen_> he he
[14:33:59] <miqlas> Sorry, i dont understand You.
[14:34:38] <Hugen_> sorry
[14:35:07] <miqlas> You want know who was this Guy?
[14:35:27] <Hugen_> Do you know with what persons you drink?
[14:35:32] <Hugen_> yea
[14:35:40] <Hugen_> ;)
[14:35:51] <miqlas> If i remember correctly his name is Jarek, but im searching now in my mail archive...
[14:36:16] <miqlas> His name is Jarek Strzelecki.
[14:36:32] <Hugen_> do you know nick?
[14:37:48] <miqlas> No. He write me an email
[14:38:01] *** mmadia has joined #haiku
[14:38:06] *** andreas_dr has quit IRC
[14:38:12] <Hugen_> aha
[14:40:05] <helf|nec> morning mmadia
[14:40:58] <mmadia> hi helf|nec :)
[14:41:35] <Hugen_> hi mmadia
[14:42:02] <helf|nec> I fired up my old laptop. it was getting lonely in its bag :P
[14:46:40] <mmadia> hi Hugen_, *
[14:50:51] *** dru_haiku has joined #haiku
[14:52:44] <CIA-9> bonefish * r30911 /haiku/trunk/ (4 files in 2 dirs): (log message trimmed)
[14:52:44] <CIA-9> * Reworked vm_soft_fault() and friends:
[14:52:45] <CIA-9> vm_soft_fault().
[14:53:08] *** Xbertl has joined #haiku
[14:54:14] *** arigayas_Zzz has joined #haiku
[14:58:15] *** Barrett` has joined #haiku
[14:58:18] *** Lelldorin1 has joined #haiku
[14:58:31] *** mattlacey has joined #haiku
[15:10:54] *** arigaya__ has quit IRC
[15:19:09] <Hugen_> bbl
[15:39:18] *** adamk_ has joined #haiku
[15:45:50] <helf|nec> jeez
[15:45:58] <helf|nec> people on the internets can't take jokes
[15:46:34] <Teknomancer> hmm
[15:54:12] <dwarfyperson> nah, just people on freenode
[15:54:18] <dwarfyperson> :P
[15:54:32] <helf|nec> hehe
[15:55:01] <helf|nec> someguy got all defensive people i told him i was sorry he was using a 603 cpu :P
[15:57:55] *** megaf has joined #Haiku
[15:59:14] <dru_haiku> it's the interwebs. arguing is the point
[15:59:25] <dru_haiku> well, went you aren;t surfing for porn
[15:59:35] <helf|nec> heh
[16:00:43] *** helf has joined #haiku
[16:01:08] <dru_haiku> is there a good way to upgrade a Haiku partition to the latest revision without doing a source rebuild or overwritting the partition with a dd of the raw image ?
[16:01:22] <helf> dont think so
[16:01:27] <dwarfyperson> there is
[16:01:33] * helf shuts up
[16:01:34] <helf> :)
[16:01:41] <dwarfyperson> but involves sacrificing your first born son to a swarm of killer bees
[16:01:44] <helf> oh, wasnt mmadia working on an update script?
[16:02:04] <dwarfyperson> and then spreading the innocent blood across your harddisk
[16:02:13] <mmadia> http://haiku.pastebin.com/f52de47ab
[16:02:14] <helf> sounds like a plan
[16:02:34] <dru_haiku> I was thinking about dding the daily to a thumbdrive, booting from it and doing a cp
[16:02:40] <dru_haiku> from it to the live part
[16:02:48] <mmadia> dru_haiku : look at that pastebin
[16:02:51] *** helf|nec has quit IRC
[16:03:14] <mmadia> it isn't a perfect solution, but it works well enough for my needs.
[16:03:33] <dru_haiku> looking.
[16:05:52] <dru_haiku> I think I get it.
[16:06:00] <dru_haiku> let's see how it goes.
[16:06:21] <dru_haiku> fwiw, I'm loving Haiku on this Acer Aspire One :-)
[16:06:28] <dru_haiku> it's a perfect match
[16:06:31] <helf> working OK?
[16:06:57] <dru_haiku> yeah, getting it set up on the hard disk the first time was a bit of a pita
[16:07:07] <oxygene> dru_haiku: load the daily image, mountvolume it, run "Installer" on the console
[16:07:08] <dru_haiku> but once it was working, it's great.
[16:07:22] <helf> what hardware isnt supported?
[16:07:31] <dru_haiku> the wireless
[16:08:04] <dru_haiku> and the card reader on the right side
[16:08:11] <helf> oh neat
[16:08:58] <dru_haiku> audio was added via third party add on
[16:12:08] <dru_haiku> I am looking forward to seeing the DriveSetup util completed, that should make it easier to set up new partitions
[16:17:59] <dru_haiku> rebooting to see if this worked :-)
[16:20:30] *** dru_haiku has quit IRC
[16:21:19] *** nikla is now known as nikla|away
[16:21:28] *** nikla|away is now known as nikla
[16:21:59] <MegafEee> hi people, is haikku gcc4 faster than gcc2?
[16:23:04] <mmadia> currently, not really.
[16:23:52] *** hisoka999 has quit IRC
[16:25:43] <Hugen_> MegafEee: not yet
[16:26:00] <Hodapp> silly gcc4.
[16:38:00] <megaf> where i cant get some buttons or logos?
[16:38:08] *** Xbertl has quit IRC
[16:39:51] *** Lelldorin1 has quit IRC
[16:42:58] *** mmadia has quit IRC
[16:44:58] *** nikla is now known as nikla|away
[16:45:41] *** nikla|away is now known as nikla
[16:47:20] *** scottmc has joined #haiku
[16:50:35] *** mattlacey has quit IRC
[16:51:57] <megaf> ok
[16:51:59] <megaf> i got it
[16:56:47] *** Xbertl has joined #haiku
[16:57:38] *** adamk_ has quit IRC
[17:00:20] *** dru_ has joined #haiku
[17:00:52] <dru_> so, it looks like the gcc4 raw builds are a little less than functional righ tnow :-)
[17:01:38] *** [r4] has joined #haiku
[17:02:54] *** franxico has joined #haiku
[17:05:18] *** VinDuv has joined #haiku
[17:09:57] *** markos_ has joined #haiku
[17:11:54] * JonathanThompson poits helf
[17:13:07] *** Barrett`_ has joined #haiku
[17:13:42] *** Barrett`_ has quit IRC
[17:14:05] *** svensko_haiku has joined #haiku
[17:14:13] *** Barrett`_ has joined #haiku
[17:14:17] <svensko_haiku> is the issue concerning unmounting and removing USB drives known?
[17:14:36] *** Barrett`_ has quit IRC
[17:14:42] *** wildur has joined #Haiku
[17:15:52] *** Barrett`_ has joined #haiku
[17:18:42] *** Xbertl has quit IRC
[17:18:43] <Teknomancer> hi JonathanThompson
[17:18:51] <JonathanThompson> Hi Teknomancer.
[17:18:55] * JonathanThompson poits Teknomancer
[17:19:01] <Teknomancer> :)
[17:19:04] <Teknomancer> how g0es it?
[17:19:09] <JonathanThompson> Horrible.
[17:19:21] <Teknomancer> depends on "it" i guess
[17:19:31] <JonathanThompson> No, not much for me, right now :/
[17:19:36] <Teknomancer> oh
[17:19:47] <Teknomancer> what about iPhone apps?
[17:20:12] <JonathanThompson> Well, if I had already had real experience writing some before 2 days ago, I'd be writing another one now, for a fee.
[17:20:28] <Teknomancer> ah yeah
[17:20:47] <JonathanThompson> So, this weekend, amidst everything else involved in moving out through no choice of my own but due to being forced to, I'll be working on getting some of that experience.
[17:20:55] <JonathanThompson> It's always slow getting started on a platform.
[17:21:19] <JonathanThompson> Or even a mild change of syntax in a language, and the iPhone/ Mac OS X has both.
[17:21:33] <Teknomancer> oh yeah :/
[17:21:36] <Teknomancer> i tried xCode on a weekend
[17:21:43] <JonathanThompson> I do have an immediate relatively simple game to create.
[17:21:44] <Teknomancer> all i understood was .. not much
[17:21:51] <Teknomancer> just played around with GUI builder
[17:21:59] *** adamk_ has joined #haiku
[17:22:01] <Teknomancer> i wanted to do AudioTagger i did for zeta for OS X
[17:22:02] <JonathanThompson> xCode is...different, especially how Interface Builder works to actually connect things up.
[17:22:05] <Teknomancer> as all the ones sucketh
[17:22:13] <Teknomancer> yeah
[17:22:31] <JonathanThompson> For all the "ease" there's some unclear things about how it is supposed to work, that aren't exactly stated.
[17:22:51] <Teknomancer> oh
[17:23:00] <JonathanThompson> It doesn't work like other interface building apps.
[17:23:02] <dru_> Teknomancer it's different, but once it all clicks, going back to other methods kinda sucks
[17:23:03] <Teknomancer> well always the things one wants to do is more than what the docs state
[17:23:28] <Teknomancer> always i need to do something at runtime, like i'm still not accustomed to the 'static compile time' gui builders
[17:23:30] <dru_> I've been doing dev for 20 years, in a myriad of languages and platforms.
[17:23:30] <JonathanThompson> That's the idea I sort of get, dru_, but still, it's foreign to my mindset right now.
[17:23:38] <Teknomancer> guess my GUI building is too based on BeOS...
[17:23:53] *** Xbertl has joined #haiku
[17:23:55] <Teknomancer> i prefer to see _everything_
[17:23:56] <dru_> and the xcode/project builder way of doing things makes soooooooo much more pleasant
[17:24:05] <Teknomancer> not let some GUI builder do stuff in a way that i can't change easily
[17:24:13] <JonathanThompson> I think once I get up to speed, I'll be able to speed through things, once I especially get accustomed to weird Objective-C @ sign usage :P
[17:24:17] <dru_> but the learning curve involves a bit of throwing out other ways
[17:25:29] <markos_> JonathanThompson: out of curiosity, is there no other way to develop for the iphone? just obj-c?
[17:25:53] <JonathanThompson> There appears to now be something mentioned on OSNews that uses Ruby and HTML, markos_.
[17:26:04] <markos_> ugh, not sure which is worse :)
[17:26:06] <Teknomancer> i'd rather learn objective C than Ruby
[17:26:08] <JonathanThompson> :P
[17:26:36] *** svensko_haiku has quit IRC
[17:26:38] <JonathanThompson> At least with Objective-C, I'll be able to do proper multithreading :P
[17:26:53] <markos_> well i was hoping for sth like python, but i guess it's too much to hope for :)
[17:26:59] * Teknomancer misses BLoopers
[17:27:15] <JonathanThompson> I suspect you CAN do that, but... I'm not sure how it'd be done atm, unless you go out of your way to do it.
[17:27:40] *** Barrett` has quit IRC
[17:28:18] <dru_> in terms of performance and usability, it's either HTML applets via http, or Objective X
[17:28:19] <dru_> C
[17:29:08] <dru_> yeah, looks like the latest gcc4 alpha image is bad
[17:30:24] <dru_> all of the directory structure is showing bad when you mount it
[17:43:26] *** urnenfeld has joined #haiku
[17:51:12] *** aljen has joined #haiku
[17:53:03] *** luroh has joined #haiku
[17:57:53] *** adamk_ has quit IRC
[17:58:42] *** adamk_ has joined #haiku
[18:00:39] *** arjen_ has joined #haiku
[18:01:45] *** paul0 has joined #haiku
[18:04:15] <helf> ok, this is messed up
[18:04:48] <helf> one of my front teeth was hurting REALLY badly all morning
[18:05:00] <helf> and drinking sweet orcold things was hurting it
[18:05:12] <helf> i started drinking dr pepper and it stopped hurting!
[18:05:17] <helf> my teeth are addicted to dr pepper!
[18:10:35] * JonathanThompson worries about helf and the helf-life of his teeth
[18:11:01] * JonathanThompson poits helf
[18:11:44] *** moster has joined #haiku
[18:12:04] *** moster has quit IRC
[18:16:54] *** VinDuv has quit IRC
[18:19:14] *** SprMa has joined #haiku
[18:19:46] *** SprMa has left #haiku
[18:20:49] *** jrsharp has joined #haiku
[18:26:44] *** andreas_dr has joined #haiku
[18:37:08] *** adamk_ has quit IRC
[18:39:26] *** jrsharp has quit IRC
[18:40:10] *** JDarkness__ has joined #haiku
[18:42:44] *** Barrett`_ has quit IRC
[18:51:57] <Hugen_> re
[18:52:38] *** ulterior_modem has joined #Haiku
[18:58:11] *** nikla is now known as nikla|away
[19:01:50] *** nikla|away is now known as nikla
[19:04:24] *** VinDuv has joined #haiku
[19:06:50] *** urnenfeld has quit IRC
[19:12:25] *** helf has quit IRC
[19:12:57] <miqlas> http://img.ircboard.com/aoi/otIrYPKa3GFhMwi4.png
[19:13:01] <miqlas> Ahahaha! :)
[19:13:04] *** Barrett` has joined #haiku
[19:16:07] *** dru_ is now known as dru_|away
[19:16:25] *** JDarkness__ has quit IRC
[19:22:10] *** philcostin has joined #haiku
[19:22:40] <megaf> geist: are you a bot?
[19:22:52] <JonathanThompson> No, you are, megaf !
[19:23:01] <megaf> am i?
[19:23:25] <megaf> so
[19:23:26] <JonathanThompson> As much as geist is ;)
[19:23:34] <megaf> i just wrote a tutorial
[19:23:36] <megaf> http://www.haiku-os.org/documents/user/how_install_haiku_your_computer
[19:23:42] <megaf> is that ok?
[19:23:47] <umccullough> why would geist be considered a bot?
[19:23:55] <umccullough> he doesn't hardly say anything
[19:24:03] *** wtracy has joined #haiku
[19:24:15] <megaf> umccullough: maybe because he doesnt speak a lot
[19:24:26] <umccullough> which is the exact opposite of a bot
[19:24:28] <megaf> 10 hours idle
[19:24:36] <megaf> ok, sorry!
[19:24:46] <markos_> that's because he analyzes the logs and tries to enhance his AI
[19:24:59] *** Paradoxon has quit IRC
[19:25:34] <umccullough> there's one quiet bot in this channel
[19:25:38] <umccullough> that i know of ;)
[19:25:52] * wtracy dumps core
[19:26:39] <umccullough> megaf, do we really need *another* installing haiku guide?
[19:27:02] <umccullough> granted, it's a slightly different variation
[19:27:13] <megaf> umccullough: i couldnt find any tutorial to install haiku on a computer
[19:27:19] <megaf> using haiku tools
[19:27:31] <megaf> not easy like that
[19:27:33] <megaf> and not in the haiku website
[19:27:37] <umccullough> we're in the process of building up a set of documentation for this already...
[19:27:59] <megaf> so, ill delete it...
[19:28:04] *** dru_|away is now known as dru_
[19:28:09] <umccullough> you can leave it for now...
[19:28:17] <megaf> nope
[19:28:18] <umccullough> you really should subscribe to the haiku-web mailing list though
[19:28:19] <megaf> deleted
[19:28:22] <markos_> ...
[19:28:30] <markos_> hasty
[19:28:37] <megaf> >:-|
[19:28:57] <megaf> i have it here... http://megafs.wordpress.com/2009/05/29/installing-haiku-os-in-your-computer-how-to/
[19:29:06] <markos_> well, you could help the guys write the official docs, or even give them a few pointers on bits they missed
[19:29:30] <umccullough> yep, this is exactly what i was complaining about a while back - everyone has their own guide on how to build/install haiku - because the haiku website has no place for people to collaborate
[19:29:46] *** glootech has quit IRC
[19:29:47] <umccullough> when the wiki was removed several years ago, it destroyed the collaboration, IMO
[19:29:54] *** andreas_dr has quit IRC
[19:30:06] <megaf> umccullough: i dont understad you
[19:30:16] <megaf> i just colaborate
[19:30:24] <megaf> i you said, you are making this
[19:30:27] <umccullough> collaboration is updating existing documentation, not writing new
[19:30:28] <megaf> tutorial
[19:30:42] <umccullough> nevermind, you're missing several years of the issue
[19:30:46] <markos_> umccullough: actually, i'd much appreciate a developer's guide rather than a installer guide, those who want to, will find a way to install, but the programming guide is sth that should be much more important. the beos guides are ok i guess, but i bet there are many things that have since changed
[19:30:48] <megaf> but there are no existing docs
[19:30:56] *** helf|laptop has joined #haiku
[19:30:59] <umccullough> megaf,... forget it
[19:31:09] <umccullough> i'll go away now
[19:31:14] <megaf> lol
[19:31:14] <helf|laptop> hey umccullough
[19:31:20] <helf|laptop> got the video card
[19:31:21] <helf|laptop> thanks
[19:31:22] <helf|laptop> :)
[19:31:25] *** mmadia has joined #haiku
[19:31:25] <megaf> make up your mind
[19:31:31] <umccullough> feel free to post your guides wherever you want - i can't stop you
[19:31:40] <umccullough> haiku website is great too, people will find them there perhaps
[19:31:41] <megaf> mmadia: you!
[19:32:08] <umccullough> my point was, posting documents everywhere in a non-organized manner just makes things worse
[19:32:10] <mmadia> what?
[19:32:28] <umccullough> np helf|laptop
[19:33:02] <megaf> hi mmadia, how are you?
[19:33:12] <markos_> megaf: this that reminded me of http://www.youtube.com/watch?v=Xo1R17Gq6dg, skip to 0:39
[19:33:13] <mmadia> catching up on the conversation i missed just now.
[19:33:21] <umccullough> http://www.haiku-os.org/search/node/installing+haiku
[19:33:27] <umccullough> look at all those not-very-useful pages :)
[19:34:18] <mmadia> megaf : as i mentioned to you yesterday, we are trying to consolidate all of the documents into one group. ....
[19:34:33] <mmadia> such that there is a single general guide that points to platform specific notes.
[19:34:48] <mmadia> i also pointed you directly to the haiku-web email thread where this was discussed. :)
[19:35:22] <mmadia> i also mentioned that you should look over the existing work at http://www.haiku-os.org/node/2500 and see what parts of your guide aren't mentioned there.
[19:35:44] <mmadia> i *greatly* appreciate anyone who willing to help re-write the documentation
[19:36:12] <mmadia> but, as umccullough mentioned above, creating a very specific guide isn't very useful at this time.
[19:36:42] <mmadia> there's also http://svn.berlios.de/svnroot/repos/haiku/haiku/trunk/docs/userguide/en/contents.html
[19:36:49] <mmadia> and http://svn.berlios.de/svnroot/repos/haiku/haiku/trunk/docs/userguide/en/installation/
[19:37:08] <umccullough> and... and...
[19:37:10] <megaf> i see
[19:37:14] <umccullough> it never ends :(
[19:37:24] <mmadia> these guides will hopefully be merged into our new documentation collection.
[19:37:30] <megaf> that is too complicated!
[19:37:42] *** wtracy has quit IRC
[19:37:57] <mmadia> rigth now, there's only one or two people who are actively working on re-organizing all of the documentation.
[19:38:18] <mmadia> so, it's not an easy task by any means :|
[19:39:13] <umccullough> we also need to decide the "lifespan" of any given documentation - some of it needs to go away once certain milestones are achieved
[19:39:20] <mmadia> iirc, i mentioned that if you're interested in helping with the website documentation, which would be *greatyl appreciated* then to subscribe to the haiku-web mailing list and to read some of the threads from May and April of this year.
[19:39:37] <umccullough> don't we have installable livecd images now?
[19:39:58] <umccullough> or...almost ;)
[19:40:01] <mmadia> almost.
[19:41:34] *** miqlas has quit IRC
[19:41:47] *** Hugen_ has quit IRC
[19:42:57] <megaf> mmadia: i have no success running haiku on qemu
[19:43:22] *** glootech has joined #haiku
[19:43:25] <megaf> beos*
[19:43:30] <mmadia> :)
[19:43:38] *** Hugen has joined #haiku
[19:43:40] <Hugen> re
[19:43:40] <megaf> it just doesnt work
[19:45:11] <megaf> mmadia: so, i keep this here or i delete? http://www.haiku-os.org/documents/user/how_install_haiku_your_computer
[19:45:27] <mmadia> since it's not published, you can leave it for now.
[19:45:46] <megaf> well, i have the same text in my blog
[19:46:00] <megaf> is a litle bit different of the tutorial i sent to you
[19:46:16] *** markos_ has quit IRC
[19:46:21] <mmadia> ok. to be very clear about this, :
[19:46:49] <mmadia> i would prefer you to read all of this email thread : http://www.freelists.org/post/haiku-web/ReviewingUpdatingCombining-howto-guides-for-buildinginstalling-Haiku
[19:46:50] <megaf> svensko: hi :)
[19:46:57] <mmadia> and decide if you'd like to help with that task
[19:47:28] <mmadia> because that thread explains what we want for the website documentation.
[19:48:06] *** miqlas has joined #haiku
[19:48:35] *** andrey___ has joined #haiku
[19:50:46] <mmadia> back in a bit.
[19:50:47] *** mmadia has quit IRC
[19:51:42] *** Kernel86_ has joined #Haiku
[19:55:56] *** korli has joined #haiku
[19:55:56] *** ChanServ sets mode: +o korli
[19:56:07] *** MegafEee has quit IRC
[20:01:44] *** Al2O3 has quit IRC
[20:07:33] *** Kernel86 has quit IRC
[20:17:02] *** andreas_dr has joined #haiku
[20:17:50] *** nikla is now known as nikla|away
[20:18:40] *** Bumphead has joined #haiku
[20:20:42] *** nikla|away is now known as nikla
[20:23:05] *** hUMUNGUs has joined #haiku
[20:26:02] *** AlexForster has joined #haiku
[20:27:33] *** andreas_dr has quit IRC
[20:27:45] *** Barrett` has quit IRC
[20:29:32] *** megaf has quit IRC
[20:30:59] *** Barrett` has joined #haiku
[20:37:12] *** hUMUNGUs has quit IRC
[20:44:55] *** Barrett`_ has joined #haiku
[20:45:57] *** Barrett` has quit IRC
[20:49:17] *** Megaf has joined #Haiku
[20:52:42] *** nikla is now known as nikla|away
[20:53:31] *** cherrypa1 has joined #haiku
[20:53:36] *** cherrypa2 has joined #haiku
[20:54:07] *** mmu_man has joined #haiku
[20:54:07] *** ChanServ sets mode: +o mmu_man
[20:55:52] *** cherrypie has quit IRC
[21:00:07] *** VinDuv is now known as VinDuv|away
[21:01:59] *** nikla|away is now known as nikla
[21:06:20] *** mmu_man has quit IRC
[21:08:11] *** cherrypai has quit IRC
[21:18:47] *** VinDuv|away is now known as VinDuv
[21:19:40] *** pfoetchen has quit IRC
[21:21:29] *** adamk_ has joined #haiku
[21:24:03] *** SiCuTDeUx_ has quit IRC
[21:25:46] *** mmadia has joined #haiku
[21:38:53] *** Hugen has quit IRC
[21:44:34] *** Barrett`_ has quit IRC
[21:44:50] *** Barrett` has joined #haiku
[21:49:57] *** xRaich[o]2x has quit IRC
[21:56:03] *** [r4] has quit IRC
[22:03:21] *** xRaich[o]2x has joined #haiku
[22:09:08] *** idefix_xifedi has joined #haiku
[22:18:53] *** xRaich[o]2x has quit IRC
[22:29:05] *** xRaich[o]2x has joined #haiku
[22:29:39] <Megaf> hehehehehe
[22:29:40] <Megaf> http://www.youtube.com/watch?v=rfqNXADl3kU&NR=1
[22:30:07] *** tqh has joined #haiku
[22:37:00] <philcostin> Megaf: http://www.youtube.com/watch?v=MYgzaAtUfQM
[22:37:18] *** tqh has quit IRC
[22:40:14] <mmadia> is a command like this functional : ?
[22:40:44] <mmadia> svn co $BUILDTOOLS_URL ${BUILDTOOLS_DIR} > ${thisLog} 2>&1 || echo "SVN Checkout Failure"
[22:42:24] *** SiCuTDeUx has joined #haiku
[22:50:50] *** idefix_xifedi has left #haiku
[22:52:20] *** Hugen_ has joined #haiku
[22:52:22] <Hugen_> re
[22:53:25] *** VinDuv has quit IRC
[22:58:12] *** Barrett` has quit IRC
[23:00:26] *** andrey___ has quit IRC
[23:04:27] *** adamk_ has quit IRC
[23:06:30] *** adamk_ has joined #haiku
[23:06:46] *** svensko has quit IRC
[23:13:28] <Megaf> haiku bootin in less then 15 seconds http://www.youtube.com/watch?v=34VQ2_BBFOI
[23:13:32] *** Ingenu has quit IRC
[23:13:33] <Megaf> in my eee
[23:15:21] <Hugen_> :)
[23:16:42] *** arjen_ has quit IRC
[23:18:54] *** xRaich[o]2x has quit IRC
[23:20:00] *** wtracy has joined #haiku
[23:23:57] <oxygene> 15 seconds? it'll be interesting once that's down to 5
[23:24:14] *** dru_ has quit IRC
[23:26:00] <Megaf> oxygene: in a modest computer
[23:29:37] <oxygene> Megaf: the boot process usually isn't that CPU intensive - it's more I/O, and most of it is making sure that the various timeouts for devices are filled with productive work elsewhere (eg. by using threads)
[23:30:10] <Megaf> oxygene: so, my eee has a modest I/O
[23:30:15] <Megaf> 66Mhz
[23:30:18] <Megaf> hm
[23:30:23] <Megaf> im not sure
[23:35:19] *** Megaf_ has joined #Haiku
[23:48:41] *** franxico has quit IRC
[23:51:21] *** MrSunshine has quit IRC
[23:52:02] *** MrSunshine has joined #haiku
[23:52:08] *** Megaf has quit IRC
[23:52:28] *** adamk_ has quit IRC
[23:53:27] <AlienSoldier> was there any service to upload a picture and have a search engine find info on it from some caracteristic and test poin?
[23:53:31] <AlienSoldier> *point
[23:55:57] <oxygene> what kind of info?
[23:58:32] *** thotypous has joined #haiku
[23:59:20] *** SiCuTDeUx has quit IRC
[23:59:20] *** visari has quit IRC
[23:59:20] *** ghane has quit IRC
[23:59:29] *** nikla is now known as nikla|away
top

   May 29, 2009  
< | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 | 17 | 18 | 19 | 20 | 21 | 22 | 23 | 24 | 25 | 26 | 27 | 28 | 29 | 30 | 31 | >